| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.087046 |
| Chromosome: | chromosome 6 |
| Location: | 8710619 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309800 | MOT57,MOT2 | Predicted protein in motile organisms; (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGCACCCCTGCGCGCAACTCTAGCAAG |
| Internal bar code: | GCGTCTTCGGAGTTCGACGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 88 |
| LEAP-Seq percent confirming: | 99.8044 |
| LEAP-Seq n confirming: | 8165 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTAGACAAGTGTTCCCCA |
| Suggested primer 2: | CCATACTCACAACGCCACAC |