| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.087068 |
| Chromosome: | chromosome 4 |
| Location: | 1267186 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215000 | BKT,CBK1,BKT1 | Beta-carotene ketolase; (1 of 1) IPR000104//IPR005804 - Antifreeze protein, type I // Fatty acid desaturase domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCTGGTCCAACCTGCTGCTGCTGGCGGG |
| Internal bar code: | AGAGTGGGGGTCGAAGGACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 99.0977 |
| LEAP-Seq n confirming: | 1318 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCACGATTGTCTACCGACT |
| Suggested primer 2: | ACACACACACACACACACGG |