| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087120 |
| Chromosome: | chromosome 2 |
| Location: | 4149396 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098100 | (1 of 1) PTHR14134//PTHR14134:SF3 - E3 UBIQUITIN-PROTEIN LIGASE RAD18 // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAAATCAAGGCTGGGACTGGAACTCA |
| Internal bar code: | GAGGGACACTCGCTATACCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 16.1109 |
| LEAP-Seq n confirming: | 430 |
| LEAP-Seq n nonconfirming: | 2239 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCGCATTGCCCTATCCTC |
| Suggested primer 2: | ACAACTTCCCACAGCAATCC |