| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.087145 |
| Chromosome: | chromosome 5 |
| Location: | 3154296 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239450 | (1 of 3) K14165 - atypical dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] (K14165) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATGTGATTGCAGCCATCCATCCAGCTT |
| Internal bar code: | GACCAAAATGCGTAAGAAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 99.0206 |
| LEAP-Seq n confirming: | 2932 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCTATGTGCTTGGGTCGC |
| Suggested primer 2: | ACCAGGACATACTTGGGCTG |