Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.087264 |
Chromosome: | chromosome 9 |
Location: | 2712749 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389600 | (1 of 57) 2.7.10.2 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase; Protein tyrosine kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACTTCCCTCTTCCGCGCCGCGCGTCGCG |
Internal bar code: | CGAATATTTTCGCCCGGAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 289 |
LEAP-Seq percent confirming: | 99.5873 |
LEAP-Seq n confirming: | 724 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAGCAATTTAAGCTCCTT |
Suggested primer 2: | CACCCATGCTCTCTGCTGTA |