| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087271 |
| Chromosome: | chromosome 2 |
| Location: | 3563102 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095130 | FAS7,FLA2 | FAS1 domain containing protein;; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGGTGACTGGTGAGGACATGCGCGGCC |
| Internal bar code: | TGGATTTCGATCTACGCAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 47.1868 |
| LEAP-Seq n confirming: | 629 |
| LEAP-Seq n nonconfirming: | 704 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGTGAACCCCTTTGCT |
| Suggested primer 2: | CTCCATCCAGCCTCTCTACG |