Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087287 |
Chromosome: | chromosome 17 |
Location: | 5451526 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g737084 | (1 of 1) PTHR15863//PTHR15863:SF2 - FAMILY NOT NAMED // UPF0544 PROTEIN C5ORF45 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGCGACAGGGGCAGTCCATGGCCGGCC |
Internal bar code: | CGTACTAGGTGTATCGAGTAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 135 |
LEAP-Seq percent confirming: | 44.9244 |
LEAP-Seq n confirming: | 624 |
LEAP-Seq n nonconfirming: | 765 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCAGAGCACGCTTCATA |
Suggested primer 2: | TCCCCAGTAGTCTTCACGCT |