| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.087300 |
| Chromosome: | chromosome 3 |
| Location: | 7671110 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203900 | (1 of 14) IPR013785 - Aldolase-type TIM barrel | CDS|intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGACACTCAGCTTCGGGGCTCATTTGC |
| Internal bar code: | GGCAAGCACGACGGCTCGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 859 |
| LEAP-Seq percent confirming: | 97.51 |
| LEAP-Seq n confirming: | 4895 |
| LEAP-Seq n nonconfirming: | 125 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTATGGGCTGTAGCTTTGC |
| Suggested primer 2: | ACATCCTCCACCTCGTCTTG |