| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.087361 |
| Chromosome: | chromosome 16 |
| Location: | 2753283 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662750 | THB11 | (1 of 6) PTHR10681//PTHR10681:SF118 - THIOREDOXIN PEROXIDASE // SUBFAMILY NOT NAMED; Truncated hemoglobin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCGCCTACGCGCCACTCGCACCACACCA |
| Internal bar code: | ACGCAATGGTCTACTCGGACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 89.9529 |
| LEAP-Seq n confirming: | 3438 |
| LEAP-Seq n nonconfirming: | 384 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCAATGCTCACCTTGAA |
| Suggested primer 2: | GCTCGCCCTGCTATACTACG |