| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087465 |
| Chromosome: | chromosome 1 |
| Location: | 6935343 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049950 | VLE1,SPO | Sporangin (Vegetative Lytic Enzyme 1); (1 of 14) 3.4.21.62 - Subtilisin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAACGTCTACCCTTGTAACCCATATCCCC |
| Internal bar code: | TCGCCGTGGGATGCGGTGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 777 |
| LEAP-Seq percent confirming: | 99.2896 |
| LEAP-Seq n confirming: | 2935 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACTTCGCTGCAATGGTG |
| Suggested primer 2: | AAGAGCGAGTCAGTCGGGTA |