| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.087498 |
| Chromosome: | chromosome 9 |
| Location: | 5612958 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400923 | FAP28 | Flagellar Associated Protein 28; (1 of 1) PTHR23315//PTHR23315:SF126 - BETA CATENIN-RELATED ARMADILLO REPEAT-CONTAINING // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGGCGAAGACACTGGCGCCGGCTCCG |
| Internal bar code: | AACTCCTCGCGCACCCGTTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 98.1982 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAACGTTTATGATGCCTT |
| Suggested primer 2: | ACTGGGTGGGCTGTCTAATG |