Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.087556 |
Chromosome: | chromosome 16 |
Location: | 6809661 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674739 | (1 of 1) PF12537 - The Golgi pH Regulator (GPHR) Family N-terminal (GPHR_N) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAGCAACTCCGCGCACCACAACAACAA |
Internal bar code: | AGTCTCGGTTTCTGTATGACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1085 |
LEAP-Seq percent confirming: | 99.5655 |
LEAP-Seq n confirming: | 4354 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCGTGCGCAAGAATATAA |
Suggested primer 2: | ACCTGACACTGGCCTTCATC |