| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087564 |
| Chromosome: | chromosome 16 |
| Location: | 4330060 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667700 | (1 of 3) IPR000104//IPR005069 - Antifreeze protein, type I // Nucleotide-diphospho-sugar transferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGGGGGAGGTGCTCGAGGGAGTGAGAG |
| Internal bar code: | GACGCTTCAGCCCAAATGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 157 |
| LEAP-Seq percent confirming: | 98.6737 |
| LEAP-Seq n confirming: | 372 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | AGTCTTCAGTGCATCCGCTT |