| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.087575 |
| Chromosome: | chromosome 3 |
| Location: | 7653215 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204100 | ELG5 | Exostosin-like glycosyltransferase 5; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATTGACCTGAGTTGCCACCTCGTCAAGT |
| Internal bar code: | GTGGCGCGCTCCAGGCGGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 347 |
| LEAP-Seq percent confirming: | 99.6513 |
| LEAP-Seq n confirming: | 1143 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACACATATGCAAACACGC |
| Suggested primer 2: | TACAGGTGCGGTTGAGACTG |