Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087581 |
Chromosome: | chromosome 2 |
Location: | 5310397 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g106850 | TPR6 | (1 of 1) PTHR22904:SF289 - CARBOXYLATE CLAMP-TETRATRICOPEPTIDE REPEAT PROTEIN-RELATED; Tetratricopeptide-repeat protein 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTACCTGTACAACACCGCATTCTCTGGA |
Internal bar code: | TTCCGTGGGCTTTCACTCCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 655 |
LEAP-Seq percent confirming: | 97.7226 |
LEAP-Seq n confirming: | 2875 |
LEAP-Seq n nonconfirming: | 67 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACACAATGTCGGGACACA |
Suggested primer 2: | ATACACGACAGGGCAACCTC |