Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.087585 |
Chromosome: | chromosome 2 |
Location: | 1363108 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g083065 | (1 of 2) 3.4.13.9 - Xaa-Pro dipeptidase / X-Pro dipeptidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAACTACCGCCCTCCGCCTTCCCCCTCC |
Internal bar code: | TCCCGGCACACGCCGTTACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 543 |
LEAP-Seq percent confirming: | 93.0309 |
LEAP-Seq n confirming: | 4512 |
LEAP-Seq n nonconfirming: | 338 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | TACCGTGTGTGTGTGTGTGC |