| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.087669 |
| Chromosome: | chromosome 9 |
| Location: | 5693026 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401515 | (1 of 1) IPR017927//IPR017938 - Ferredoxin reductase-type FAD-binding domain // Riboflavin synthase-like beta-barrel | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAGGCAATTGCTTCCGGAAGCGCGCTG |
| Internal bar code: | GCTCTGCCCGAGTAGGTACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 99.1456 |
| LEAP-Seq n confirming: | 4990 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGGGTGAGGATGGTAATC |
| Suggested primer 2: | AGCTGGTGCTGTTGGAGTCT |