| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087676 |
| Chromosome: | chromosome 17 |
| Location: | 5085304 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734900 | (1 of 1) 3.4.17.19 - Carboxypeptidase Taq / Carboxypeptidase 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGGAGGTGTTGGCACACATGAGGGGTT |
| Internal bar code: | AGCGACTGGGCTCGGGATTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 545 |
| LEAP-Seq percent confirming: | 52.5901 |
| LEAP-Seq n confirming: | 4802 |
| LEAP-Seq n nonconfirming: | 4329 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTGGTGGGTATCTCTAA |
| Suggested primer 2: | CCCAGCACAACTCTCTCTCC |