| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.087692 |
| Chromosome: | chromosome_1 |
| Location: | 7243873 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre01.g052150 | ANK2,FAP87 | Flagellar Associated Protein with ankyrin repeats | antisense | CDS |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | TTTGCGAATGTGGCCATCGTCTCCTCCAGC |
| Internal bar code: | CGACCGAGCGAATGGTGGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 98.8536 |
| LEAP-Seq n confirming: | 4570 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCGCTACCAAAGCTTCCA |
| Suggested primer 2: | GAGAGTCTTTGCCTGCAACC |