Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087739 |
Chromosome: | chromosome 7 |
Location: | 292698 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g314200 | (1 of 726) IPR011009 - Protein kinase-like domain | 3'UTR/3'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGTGGGTTGAGTGGGATTGCGATTGCT |
Internal bar code: | TGGGACAAACGTACATGCCCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 365 |
LEAP-Seq percent confirming: | 48.3146 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 46 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCAGCTAGTAACCACTGC |
Suggested primer 2: | GCCTACTAAGCACACGCCTC |