Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087783 |
Chromosome: | chromosome 5 |
Location: | 3337328 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g240650 | DNJ32 | (1 of 1) K09506 - DnaJ homolog subfamily A member 5 (DNAJA5); DnaJ-like protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCGGCTGACATCGAGGACGACGAGGA |
Internal bar code: | GATGATACTACTGAGGGTATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 133 |
LEAP-Seq percent confirming: | 72.5841 |
LEAP-Seq n confirming: | 1337 |
LEAP-Seq n nonconfirming: | 505 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTAAACGCTCCCACTGCT |
Suggested primer 2: | GCCTTTCGCTTCTCCTTCTT |