Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.087788 |
Chromosome: | chromosome 13 |
Location: | 5090512 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607200 | CYG42 | (1 of 5) IPR000104//IPR001054//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase; Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTGTGACGCGTGTACCGCGCCGTTGAA |
Internal bar code: | GGAGCATGAGGGTTTGGCGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 779 |
LEAP-Seq percent confirming: | 98.4402 |
LEAP-Seq n confirming: | 1704 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACTGGCGACTCCTATGGTG |
Suggested primer 2: | CCCGTTAATGAGACGCAAAT |