Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087788 |
Chromosome: | chromosome 16 |
Location: | 3745863 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689150 | SQD3,GTR23 | Sulfoquinovosyldiacylglycerol synthase; (1 of 2) K06119 - sulfoquinovosyltransferase (SQD2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTCGCCTGCTCGTTCTCAGTCGAATGA |
Internal bar code: | GCTGTTCTTCCGCGCGGGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1807 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAGCGGTATGAAGGGTTC |
Suggested primer 2: | TTCTACTCCTCGCCCACACT |