| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.087884 |
| Chromosome: | chromosome 2 |
| Location: | 2555346 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092750 | RRM3,SSA18 | Putative ribosomal RNA methyltransferase; (1 of 1) 2.1.1.296//2.1.1.57 - Methyltransferase cap2 / mRNA (nucleoside-2'-O)-methyltransferase // Methyltransferase cap1 / mRNA (nucleoside-2'-O)-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGTGACGGGCGCACCAGTGGAAGCAG |
| Internal bar code: | CCCAGTGCTGAGCTAAACCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 832 |
| LEAP-Seq percent confirming: | 99.8338 |
| LEAP-Seq n confirming: | 4805 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACATGACGCAAAACCAA |
| Suggested primer 2: | GATAAGCAGTGGCGAGGAAG |