Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.087899 |
Chromosome: | chromosome 6 |
Location: | 1629065 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260800 | (1 of 1) K05755 - actin related protein 2/3 complex, subunit 4 (ARPC4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACGGACTGCTGGCAAGACTGGTCCCTT |
Internal bar code: | TCATATCGACCGCGGCGGATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 270 |
LEAP-Seq percent confirming: | 95.1771 |
LEAP-Seq n confirming: | 1263 |
LEAP-Seq n nonconfirming: | 64 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGCACTCTCATCACAGCC |
Suggested primer 2: | ACCGAACACAACCACTAGGC |