| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.088005 |
| Chromosome: | chromosome 6 |
| Location: | 8605875 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309000 | NAR1B,LCIA | Formate/nitrite transporter; (1 of 7) PTHR30520//PTHR30520:SF0 - FORMATE TRANSPORTER-RELATED // FORMATE TRANSPORTER 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCGGCGGAGGCGGACCACACGGCGCAG |
| Internal bar code: | CGTAGTGATAGGCTGGGTTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 351 |
| LEAP-Seq percent confirming: | 99.7848 |
| LEAP-Seq n confirming: | 1391 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCCATGGTGACCAACTG |
| Suggested primer 2: | CACCCACAACAAGACACCTG |