| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.088021 |
| Chromosome: | chromosome 2 |
| Location: | 5182520 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105550 | (1 of 1) IPR000104//IPR003008 - Antifreeze protein, type I // Tubulin/FtsZ, GTPase domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGAAGCAACCCAGCAGCGGCGCTGCCCA |
| Internal bar code: | AGTTGGGGTTTTGCTCCCTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 540 |
| LEAP-Seq percent confirming: | 98.8895 |
| LEAP-Seq n confirming: | 7569 |
| LEAP-Seq n nonconfirming: | 85 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACTGCGACTCGGAAAGAC |
| Suggested primer 2: | GTACAATGCGGTGTACCGTG |