| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.088079 |
| Chromosome: | chromosome 6 |
| Location: | 2280975 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g266900 | LPA1L | Low PSII Accumulation 1 homolog; (1 of 2) PF11998 - Protein of unknown function (DUF3493) (DUF3493) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATGCCTGGCGGCCTCAGAGCCGACACC |
| Internal bar code: | TCTGTTCTTGCTTCTACAGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 271 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTCCTGGTTTGAGCAGC |
| Suggested primer 2: | GAAGGCCTGCTTCACAAGTC |