| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088088 |
| Chromosome: | chromosome 5 |
| Location: | 3065385 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238900 | HEL25 | (1 of 1) K14779 - ATP-dependent RNA helicase DDX52/ROK1 [EC:3.6.4.13] (DDX52, ROK1); DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTAACAGACGCAAGTGAGAAGAGGCTAT |
| Internal bar code: | GCCTACCACCACTATCGACTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 643 |
| LEAP-Seq percent confirming: | 98.6926 |
| LEAP-Seq n confirming: | 3548 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCTGACGCCTTACCCTA |
| Suggested primer 2: | CACTGGCCTCTCAGACACAA |