| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.088092 |
| Chromosome: | chromosome 2 |
| Location: | 6997111 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g147900 | PYK5 | Pyruvate kinase 5; (1 of 6) 2.7.1.40 - Pyruvate kinase / Phosphoenolpyruvate kinase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGATTGGCGCTCAGCGGCTGCGAGAGG |
| Internal bar code: | GCCCCAAACGGCACGGTGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 98.0732 |
| LEAP-Seq n confirming: | 509 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGCTCTTCTCGAGGTC |
| Suggested primer 2: | TTATCCAGGGTCTCCTGGTG |