Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.088179 |
Chromosome: | chromosome 2 |
Location: | 285369 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g075050 | PTA1 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGACTCCGCCGCAGAACACTGCTGACCC |
Internal bar code: | GGGGTTTGCTTAAAGTATTAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1394 |
LEAP-Seq percent confirming: | 99.8999 |
LEAP-Seq n confirming: | 1997 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCGCTTGATATTCAGCTT |
Suggested primer 2: | CGGTACCCTGATGTCGAGTT |