| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.088348 |
| Chromosome: | chromosome 6 |
| Location: | 1253056 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257950 | AST4 | (1 of 1) K14455 - aspartate aminotransferase, mitochondrial (GOT2); aspartate aminotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAGTTCAGGACACCTCGGCACGTCGTC |
| Internal bar code: | GTACGAGATCAAACGGGGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 715 |
| LEAP-Seq percent confirming: | 99.4112 |
| LEAP-Seq n confirming: | 3039 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGTGAGGTGTAGAAGAGC |
| Suggested primer 2: | CATGTCAGGGTCGTGTGTTC |