| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.088396 |
| Chromosome: | chromosome 6 |
| Location: | 6087173 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g289800 | CAM12 | Calmodulin-like protein; (1 of 1) 2.3.1.23//2.3.1.51//2.3.1.67 - 1-acylglycerophosphocholine O-acyltransferase / Lysolecithin acyltransferase // 1-acylglycerol-3-phosphate O-acyltransferase // 1-alkylglycerophosphocholine O-acetyltransferase / Platelet-activating factor-synthesizing enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACTTCCGGAGCTCGATCGGGGGGGGGG |
| Internal bar code: | CGTTACCGAGGGTGACTACAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1110 |
| LEAP-Seq percent confirming: | 99.8175 |
| LEAP-Seq n confirming: | 3828 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGCTCTAAGCCTAATGCC |
| Suggested primer 2: | TGCTGGCAGAGATACAGGTG |