Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.088422 |
Chromosome: | chromosome 4 |
Location: | 110906 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g216700 | PHOX,PHO5 | Phosphate-repressible alkaline phosphatase; (1 of 2) 3.1.3.1 - Alkaline phosphatase / Phosphomonoesterase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTGGCCGCTGCTGTCCTCGGCAATGAA |
Internal bar code: | CGGGGTTCATTTCGGTGCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 675 |
LEAP-Seq percent confirming: | 96.3624 |
LEAP-Seq n confirming: | 40133 |
LEAP-Seq n nonconfirming: | 1515 |
LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGAACAGGTAGGAGTCGC |
Suggested primer 2: | TTCTGCTCTTGTGGTGTTGC |