| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088440 |
| Chromosome: | chromosome 10 |
| Location: | 865766 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423800 | KU80 | (1 of 1) K10885 - ATP-dependent DNA helicase 2 subunit 2 (XRCC5, KU80, G22P2); ATP-dependent DNA helicase 2 subunit KU80 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGAGTTGCAGTGCGGCATGAGTAATGGC |
| Internal bar code: | AGGCTGCAGGACGAATGCAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 507 |
| LEAP-Seq percent confirming: | 98.9454 |
| LEAP-Seq n confirming: | 5911 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTGATAGTGGCAGTGA |
| Suggested primer 2: | TGTGTGATATCTACCCGCCA |