| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088445 |
| Chromosome: | chromosome 6 |
| Location: | 3269115 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g276800 | HFO1,HFO24 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCTTGAGCACCGTGCGAGTCTCCTCGTA |
| Internal bar code: | TGACTGTGGTGCAGCGTACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 882 |
| LEAP-Seq percent confirming: | 98.0352 |
| LEAP-Seq n confirming: | 3393 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTTTGGTTGTTAATGCCA |
| Suggested primer 2: | GGGCCATTTTTGCTGAGATA |