| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088466 |
| Chromosome: | chromosome 1 |
| Location: | 5558951 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039500 | FAP89 | Flagellar Associated Protein 89; (1 of 3) PTHR22847:SF361 - JOUBERIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGCGTGCTCCTGCTTACCGGCAGCGTGG |
| Internal bar code: | GGAACAGACCTACCGAGGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 99.0374 |
| LEAP-Seq n confirming: | 6379 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCTAAATCGGGATAAACA |
| Suggested primer 2: | CCTGGGGTGACCGTACTCTA |