Insertion junction: LMJ.RY0402.088534_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.088534
Chromosome:chromosome_6
Location:6636205
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g293900 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCAGCACCCAGCCAGCGCTAGCTCTCGTCC
Internal bar code:CACTTCAACACGAGGGCATGCG

Confirmation - LEAP-Seq

LEAP-Seq distance:289
LEAP-Seq percent confirming:87.5
LEAP-Seq n confirming:7
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GCTGGCCCTCTGAGTACTTG
Suggested primer 2:TACCGTACTCGACCCCACTC