Insertion junction: LMJ.RY0402.088534_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.088534
Chromosome:chromosome_6
Location:6636206
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g293900 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCGTGCGCACCAGTGCGCGCTGCCAGGCG
Internal bar code:CTACCAGTGCCTTGGCCTGCAA

Confirmation - LEAP-Seq

LEAP-Seq distance:452
LEAP-Seq percent confirming:99.0028
LEAP-Seq n confirming:1390
LEAP-Seq n nonconfirming:14
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TACCGTACTCGACCCCACTC
Suggested primer 2:GCTGGCCCTCTGAGTACTTG