| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088534 |
| Chromosome: | chromosome 6 |
| Location: | 6636206 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293900 | (1 of 1) PTHR23333:SF4 - UBX DOMAIN-CONTAINING PROTEIN 11 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTGCGCACCAGTGCGCGCTGCCAGGCG |
| Internal bar code: | CTACCAGTGCCTTGGCCTGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 99.0028 |
| LEAP-Seq n confirming: | 1390 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCGTACTCGACCCCACTC |
| Suggested primer 2: | GCTGGCCCTCTGAGTACTTG |