| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088541 |
| Chromosome: | chromosome 11 |
| Location: | 465373 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467592 | Probable amino acid/metabolite permease; (1 of 1) PTHR11785//PTHR11785:SF228 - AMINO ACID TRANSPORTER // GABA-SPECIFIC PERMEASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACAAGCAACTTGTCACACAAGCGAAGC |
| Internal bar code: | GACATGGCATCCCGTTGGCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 515 |
| LEAP-Seq percent confirming: | 97.9904 |
| LEAP-Seq n confirming: | 4291 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACCTAGCCGAACTAGCG |
| Suggested primer 2: | TCTCATATCTGGAGGGTGGC |