| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.088572 |
| Chromosome: | chromosome 2 |
| Location: | 4318549 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099100 | (1 of 3) K10587 - ubiquitin-protein ligase E3 A (UBE3A, E6AP); RCC-type HECT ubiquitin ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATACAGATGGCTGCCGCCGCTGCCGCC |
| Internal bar code: | AGGAACCGAGCGGCGTCTAAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 140 |
| LEAP-Seq percent confirming: | 99.1803 |
| LEAP-Seq n confirming: | 242 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATTGGAACAATGGCAGGC |
| Suggested primer 2: | ATGCTAGGGCAACAAACACC |