Insertion junction: LMJ.RY0402.088611_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.088611
Chromosome:chromosome_2
Location:3650400
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g095149 FAP143 Flagellar Associated Protein sense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGCTTGTTGCCACTCCGGCCCTTCTGTATC
Internal bar code:GGGGAGAACGTGAAGGAGGGAA

Confirmation - LEAP-Seq

LEAP-Seq distance:670
LEAP-Seq percent confirming:99.2358
LEAP-Seq n confirming:3636
LEAP-Seq n nonconfirming:28
LEAP-Seq n unique pos:45

Suggested primers for confirmation by PCR

Suggested primer 1:TGAAGGAAGCAGCATTTGTG
Suggested primer 2:CCCAGTCTGAGCTGAGTTCC