Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.088618 |
Chromosome: | chromosome 12 |
Location: | 5149073 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g527100 | (1 of 1) IPR002048//IPR003439//IPR003593//IPR027417 - EF-hand domain // ABC transporter-like // AAA+ ATPase domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGACAACTGGCCACGTGGTACTTGTGA |
Internal bar code: | GACGATGGCAGAATTAGGATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 749 |
LEAP-Seq percent confirming: | 98.88 |
LEAP-Seq n confirming: | 5562 |
LEAP-Seq n nonconfirming: | 63 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCTCACAACACCCCAACT |
Suggested primer 2: | TAGCCATGTGCCATCCATAA |