| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.088708 |
| Chromosome: | chromosome 10 |
| Location: | 177416 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418950 | KIN10-2,KIN10B,KIN4-4,IAR1 | Kinesin motor protein; (1 of 2) PTHR24115:SF136 - KLP31E, ISOFORM A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCACCAGCCGGTCTCTACGATGTTGG |
| Internal bar code: | TTTAGGGTATGACCTTCGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 380 |
| LEAP-Seq percent confirming: | 99.7778 |
| LEAP-Seq n confirming: | 5389 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAGTTAGACCTCACCGGC |
| Suggested primer 2: | GAGACCTGCACCTAACAGGC |