| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.088856 |
| Chromosome: | chromosome 17 |
| Location: | 1804429 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g709550 | (1 of 2) K06709 - jumonji domain-containing protein 2 [EC:1.14.11.-] (JMJD2, JHDM3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTCCGCAGCACGGCAGCCAGAAGGTGC |
| Internal bar code: | AAGTAGGAGATATGCTGAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 761 |
| LEAP-Seq percent confirming: | 91.0224 |
| LEAP-Seq n confirming: | 5475 |
| LEAP-Seq n nonconfirming: | 540 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGGGTGTTGCAAAGTTA |
| Suggested primer 2: | TCTCGTCAAAGAACGACACG |