| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.088869 |
| Chromosome: | chromosome 14 |
| Location: | 71499 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608200 | (1 of 1) PF12872//PF13020 - OST-HTH/LOTUS domain (OST-HTH) // Domain of unknown function (DUF3883) (DUF3883) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATGAATACACCCCACACCACGCACACC |
| Internal bar code: | ACTCTGCGCTTGCGGTGAGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 99.0196 |
| LEAP-Seq n confirming: | 505 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAAGTACGGCAGGGTGAG |
| Suggested primer 2: | GCTGTCCCACACAGGGTTAT |