| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.088948 |
| Chromosome: | chromosome 5 |
| Location: | 2749534 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236907 | (1 of 1) IPR000572//IPR014720 - Oxidoreductase, molybdopterin-binding domain // Double-stranded RNA-binding domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGGGCGGGCTTCCGATCCTTTGTTGCG |
| Internal bar code: | GTCCATGTGTGGACGGTCGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 963 |
| LEAP-Seq percent confirming: | 98.5552 |
| LEAP-Seq n confirming: | 4775 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGCATGAAAACGTGCTA |
| Suggested primer 2: | GATGCCGTATGGTGCCTACT |