| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089008 |
| Chromosome: | chromosome 12 |
| Location: | 4098480 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517900 | SCA1,SECA1 | (1 of 1) K03070 - preprotein translocase subunit SecA (secA); Chloroplast-associated SecA protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCCATAGGCAATGCGGGGCCACGAGCA |
| Internal bar code: | CGACGCTTGAGACGCTGAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 192 |
| LEAP-Seq percent confirming: | 90.6367 |
| LEAP-Seq n confirming: | 484 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCTGAGCGTACTGAGAGA |
| Suggested primer 2: | TTCTTGGTGAGCTTGTGTCG |