| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089116 |
| Chromosome: | chromosome 6 |
| Location: | 2951484 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273000 | Protein Kinase C Binding Protein; (1 of 1) K02503 - histidine triad (HIT) family protein (HINT1, hinT, hit) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGTGACCCTCGGGCGGCTGCGCAGGCG |
| Internal bar code: | ACCGTTGGAACCAGGCCCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 632 |
| LEAP-Seq percent confirming: | 99.2105 |
| LEAP-Seq n confirming: | 3393 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTGCCTTGAGCTGTGATA |
| Suggested primer 2: | CTTCATGCACGAGTCCTCAA |