Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.089118 |
Chromosome: | chromosome 12 |
Location: | 136617 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g484350 | CKIN beta-gamma,SNRKBG1 | regulatory subunit beta-gamma of snRK1 complex in Chlamydomonas; (1 of 1) K07200 - 5'-AMP-activated protein kinase, regulatory gamma subunit (PRKAG) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACCCTGGCAGGGCGGGACGTGTAGATG |
Internal bar code: | TTTCGGGCCCTTTCTTCCGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 812 |
LEAP-Seq percent confirming: | 97.6838 |
LEAP-Seq n confirming: | 7254 |
LEAP-Seq n nonconfirming: | 172 |
LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTACTGACCGACGATGTT |
Suggested primer 2: | TATACACGTCACGTCCGCAT |